ID: 1006301751_1006301754

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006301751 1006301754
Species Human (GRCh38) Human (GRCh38)
Location 6:33197296-33197318 6:33197323-33197345
Sequence CCTAGGAATCTGACTTAAGAAGA ATGGAGACACAGAAGAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 344} {0: 1, 1: 1, 2: 23, 3: 190, 4: 1370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!