ID: 1006303475_1006303485

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006303475 1006303485
Species Human (GRCh38) Human (GRCh38)
Location 6:33206231-33206253 6:33206267-33206289
Sequence CCAAAGTTTGGGGATTTTCTAGG GTGTCTGTGGAGAGGTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 186} {0: 1, 1: 0, 2: 2, 3: 34, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!