ID: 1006316157_1006316170

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1006316157 1006316170
Species Human (GRCh38) Human (GRCh38)
Location 6:33293122-33293144 6:33293148-33293170
Sequence CCCCCGGAGGCCTCTTCTGCACC ACTCAGCGGGGAGCCACAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 210} {0: 1, 1: 0, 2: 2, 3: 18, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!