ID: 1006316566_1006316580

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1006316566 1006316580
Species Human (GRCh38) Human (GRCh38)
Location 6:33295261-33295283 6:33295300-33295322
Sequence CCCTCTTCCCCGCCTTCTGAGGA AATGCCTCAGCCTCCGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 251} {0: 1, 1: 0, 2: 6, 3: 24, 4: 1133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!