ID: 1006320212_1006320218

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006320212 1006320218
Species Human (GRCh38) Human (GRCh38)
Location 6:33315560-33315582 6:33315574-33315596
Sequence CCCCGTGTTCTGCTTGGTTCCCT TGGTTCCCTGGTGGTTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170} {0: 1, 1: 0, 2: 0, 3: 14, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!