ID: 1006334653_1006334655

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1006334653 1006334655
Species Human (GRCh38) Human (GRCh38)
Location 6:33414325-33414347 6:33414339-33414361
Sequence CCCTTCACTTCTGAGAATTGGGA GAATTGGGACAGTTTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 205} {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!