ID: 1006337524_1006337540

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1006337524 1006337540
Species Human (GRCh38) Human (GRCh38)
Location 6:33428179-33428201 6:33428226-33428248
Sequence CCGCGCGCGTGGGGCGGGGGCGC GGGTGGGGAAGCCGCGGTGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 29, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!