ID: 1006339452_1006339456

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1006339452 1006339456
Species Human (GRCh38) Human (GRCh38)
Location 6:33438674-33438696 6:33438692-33438714
Sequence CCAGCCTCCAACACCTGATTCTG TTCTGAAATTTCCCCAACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 284} {0: 1, 1: 0, 2: 0, 3: 17, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!