ID: 1006351116_1006351131

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006351116 1006351131
Species Human (GRCh38) Human (GRCh38)
Location 6:33521775-33521797 6:33521826-33521848
Sequence CCAGCCGGCTGCTCCGAGTGTGG CTCGAGCTGGCGCGCAGCCCTGG
Strand - +
Off-target summary {0: 32, 1: 197, 2: 325, 3: 337, 4: 422} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!