ID: 1006358430_1006358436

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1006358430 1006358436
Species Human (GRCh38) Human (GRCh38)
Location 6:33574041-33574063 6:33574079-33574101
Sequence CCCCTCTGTGCAATCCACCGGGC CATGAAGTCGACCACGAAGCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 85} {0: 1, 1: 0, 2: 1, 3: 0, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!