ID: 1006358829_1006358837

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1006358829 1006358837
Species Human (GRCh38) Human (GRCh38)
Location 6:33576211-33576233 6:33576245-33576267
Sequence CCACCTACTCAAGAAGAGGCTGA TACTTGACCCCGGGAGGCGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 180, 2: 11450, 3: 69596, 4: 163482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!