ID: 1006359490_1006359503

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1006359490 1006359503
Species Human (GRCh38) Human (GRCh38)
Location 6:33579480-33579502 6:33579525-33579547
Sequence CCAACTCCCTCTACCAACACCCC GAGCCTCAGAACACCCACCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 747} {0: 1, 1: 0, 2: 1, 3: 10, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!