ID: 1006367045_1006367058

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1006367045 1006367058
Species Human (GRCh38) Human (GRCh38)
Location 6:33621883-33621905 6:33621934-33621956
Sequence CCCTACTGGAGTTGGCAGGAGGA TCCCGCGCACGCCTTTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 182} {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!