ID: 1006375033_1006375040

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006375033 1006375040
Species Human (GRCh38) Human (GRCh38)
Location 6:33667332-33667354 6:33667367-33667389
Sequence CCTTCCTCAGCAAGCGATTTCCT CTGTGCCAGGCACTGTTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 139} {0: 1, 1: 0, 2: 32, 3: 207, 4: 875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!