ID: 1006397870_1006397874

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1006397870 1006397874
Species Human (GRCh38) Human (GRCh38)
Location 6:33798752-33798774 6:33798775-33798797
Sequence CCTTGCTCCAGCTGTTTGCACAG GTGGCTCCTTCCCTTCATTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 289} {0: 1, 1: 0, 2: 7, 3: 48, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!