ID: 1006429153_1006429157

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1006429153 1006429157
Species Human (GRCh38) Human (GRCh38)
Location 6:33984503-33984525 6:33984527-33984549
Sequence CCAGGCCAGGGGCGCTGGGGGAA CAGGCTCAGGCCCGCCGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 70, 4: 421} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!