ID: 1006435425_1006435439

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006435425 1006435439
Species Human (GRCh38) Human (GRCh38)
Location 6:34023606-34023628 6:34023634-34023656
Sequence CCCCTTTTCTGCCCCTGTCCCTC CTTACTCCACACCAGGACTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 100, 4: 847} {0: 1, 1: 0, 2: 2, 3: 15, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!