ID: 1006452165_1006452180

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1006452165 1006452180
Species Human (GRCh38) Human (GRCh38)
Location 6:34111626-34111648 6:34111669-34111691
Sequence CCCATGGGAGAACCAGCCTGGCA CAAGAGCTGATGGGCTGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 12, 3: 37, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!