ID: 1006453314_1006453324

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006453314 1006453324
Species Human (GRCh38) Human (GRCh38)
Location 6:34117795-34117817 6:34117848-34117870
Sequence CCACCCAGCACCCAAGGCTGCAC GGAAATACATAGATGCAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 15, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!