ID: 1006453316_1006453324

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1006453316 1006453324
Species Human (GRCh38) Human (GRCh38)
Location 6:34117799-34117821 6:34117848-34117870
Sequence CCAGCACCCAAGGCTGCACTGTC GGAAATACATAGATGCAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 227} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!