ID: 1006457483_1006457492

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1006457483 1006457492
Species Human (GRCh38) Human (GRCh38)
Location 6:34140246-34140268 6:34140298-34140320
Sequence CCTGAGGTGGGCACAGGCTTGGC CAACGTGACCAGGGGGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 407} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!