ID: 1006457566_1006457575

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1006457566 1006457575
Species Human (GRCh38) Human (GRCh38)
Location 6:34140687-34140709 6:34140724-34140746
Sequence CCTCTCCTCCCCATCCCTACATG TTTCCAGCACAAGACCCAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 66, 4: 707} {0: 1, 1: 0, 2: 0, 3: 9, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!