ID: 1006459879_1006459889

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006459879 1006459889
Species Human (GRCh38) Human (GRCh38)
Location 6:34152168-34152190 6:34152221-34152243
Sequence CCATGGACAATGTTTGCTCCTTC GAGAGCTGGACGTAGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 187} {0: 1, 1: 0, 2: 0, 3: 15, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!