ID: 1006510260_1006510265

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1006510260 1006510265
Species Human (GRCh38) Human (GRCh38)
Location 6:34517550-34517572 6:34517567-34517589
Sequence CCCTTGCTCCTCAAGCCTGGCAG TGGCAGCCGGCTTCTGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 315} {0: 1, 1: 0, 2: 1, 3: 27, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!