ID: 1006510484_1006510488

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1006510484 1006510488
Species Human (GRCh38) Human (GRCh38)
Location 6:34518633-34518655 6:34518666-34518688
Sequence CCGCTGGAGAGCTCTGGGAGGGG ACCTTTGACTCAGTCCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 351} {0: 1, 1: 0, 2: 0, 3: 9, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!