|
Left Crispr |
Right Crispr |
Crispr ID |
1006530960 |
1006530966 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:34653451-34653473
|
6:34653472-34653494
|
Sequence |
CCTCATCTGAAGTGATCCTCCCA |
CACCTCGGCCTCCCAAAGCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 9, 2: 334, 3: 4909, 4: 39903} |
{0: 9, 1: 61, 2: 431, 3: 1471, 4: 2854} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|