ID: 1006533148_1006533149

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1006533148 1006533149
Species Human (GRCh38) Human (GRCh38)
Location 6:34674565-34674587 6:34674582-34674604
Sequence CCAAAAATCAGTTGAAAGAATTG GAATTGAAACAGATTGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 396} {0: 1, 1: 0, 2: 2, 3: 25, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!