ID: 1006535593_1006535607

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1006535593 1006535607
Species Human (GRCh38) Human (GRCh38)
Location 6:34696591-34696613 6:34696643-34696665
Sequence CCATGCCCTCCATGGCGGGGACC CAAGCCGCCGCCGCGCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147} {0: 1, 1: 0, 2: 3, 3: 29, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!