ID: 1006556725_1006556734

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1006556725 1006556734
Species Human (GRCh38) Human (GRCh38)
Location 6:34873268-34873290 6:34873314-34873336
Sequence CCTGTTGTCCGCCTGGAGTCCTG GTGGCTCTTCTGTCTCCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137} {0: 1, 1: 0, 2: 2, 3: 39, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!