ID: 1006604153_1006604160

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1006604153 1006604160
Species Human (GRCh38) Human (GRCh38)
Location 6:35244192-35244214 6:35244222-35244244
Sequence CCAATTTCCCAGAGGGGACACTG ATTTTCTCCAAACCAGTAATGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 390} {0: 1, 1: 0, 2: 3, 3: 32, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!