ID: 1006620514_1006620520

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1006620514 1006620520
Species Human (GRCh38) Human (GRCh38)
Location 6:35360777-35360799 6:35360813-35360835
Sequence CCATCCCCGATTTATTTTTAGAG TCTGTTCCCATTTCTTGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 219} {0: 1, 1: 0, 2: 4, 3: 27, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!