ID: 1006630539_1006630549

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1006630539 1006630549
Species Human (GRCh38) Human (GRCh38)
Location 6:35427157-35427179 6:35427188-35427210
Sequence CCTGGCCTCACATCCCCCTGCTC AGCTGGCTCCACGGGAGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 83, 4: 553} {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!