ID: 1006634535_1006634544

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006634535 1006634544
Species Human (GRCh38) Human (GRCh38)
Location 6:35452533-35452555 6:35452552-35452574
Sequence CCCGTGCCCCGGCATGGCGACAC ACACCGGACGCGGGGCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90} {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!