ID: 1006645345_1006645355

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006645345 1006645355
Species Human (GRCh38) Human (GRCh38)
Location 6:35511616-35511638 6:35511643-35511665
Sequence CCCTCACCCGCGTCCCTGGGGCC CTCACCGTCCTCCGCGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 255} {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!