ID: 1006688889_1006688893

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1006688889 1006688893
Species Human (GRCh38) Human (GRCh38)
Location 6:35862287-35862309 6:35862306-35862328
Sequence CCACTAATGCCACCATCAGGGTC GGTCCAAAGACTGGCTCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160} {0: 1, 1: 0, 2: 5, 3: 34, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!