ID: 1006717179_1006717199

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1006717179 1006717199
Species Human (GRCh38) Human (GRCh38)
Location 6:36128095-36128117 6:36128134-36128156
Sequence CCCCGTTCCTTAGGCTCTCATGG TAGGGGGTGGGGGAGGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 110} {0: 1, 1: 1, 2: 34, 3: 399, 4: 2970}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!