ID: 1006726846_1006726848

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1006726846 1006726848
Species Human (GRCh38) Human (GRCh38)
Location 6:36205385-36205407 6:36205408-36205430
Sequence CCACACTGCTGCTCCAGAGATGA AGCAAAGCTTTATGTGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 232} {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!