ID: 1006739055_1006739071

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1006739055 1006739071
Species Human (GRCh38) Human (GRCh38)
Location 6:36294348-36294370 6:36294393-36294415
Sequence CCTGGAGAACATCGCCAGGATGA CCTGGTGGTGAGAGGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109} {0: 1, 1: 0, 2: 3, 3: 87, 4: 709}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!