ID: 1006739055_1006739075

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1006739055 1006739075
Species Human (GRCh38) Human (GRCh38)
Location 6:36294348-36294370 6:36294401-36294423
Sequence CCTGGAGAACATCGCCAGGATGA TGAGAGGCAGGAGGGGTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 109} {0: 1, 1: 0, 2: 8, 3: 95, 4: 746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!