ID: 1006740811_1006740816

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1006740811 1006740816
Species Human (GRCh38) Human (GRCh38)
Location 6:36307111-36307133 6:36307148-36307170
Sequence CCACTCTGGCAGTAGCTGGGTTT CTGCAGGTATTGAGAGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!