ID: 1006750009_1006750025

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1006750009 1006750025
Species Human (GRCh38) Human (GRCh38)
Location 6:36371300-36371322 6:36371352-36371374
Sequence CCATGGCCAGAGGAACAGCCTCC GGCCTGCGGCATCGCGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 310} {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!