ID: 1006763178_1006763185

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1006763178 1006763185
Species Human (GRCh38) Human (GRCh38)
Location 6:36481729-36481751 6:36481756-36481778
Sequence CCTCCACCAATGGGGGAGGAATA CAAAGTAGGAGCTTCTGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123} {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!