ID: 1006781034_1006781038

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1006781034 1006781038
Species Human (GRCh38) Human (GRCh38)
Location 6:36632444-36632466 6:36632483-36632505
Sequence CCTCTCCTACTAATAATCACATC CCCTGAACGTGATTACACGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!