ID: 1006787627_1006787639

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1006787627 1006787639
Species Human (GRCh38) Human (GRCh38)
Location 6:36679084-36679106 6:36679112-36679134
Sequence CCCCTGGAAACCCAGCTGGGGCG GGGCGTGGACGGGACCGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 200} {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!