ID: 1006788940_1006788943

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1006788940 1006788943
Species Human (GRCh38) Human (GRCh38)
Location 6:36686282-36686304 6:36686315-36686337
Sequence CCTCACCGAGTGGGGGCATCATC GAGTCCCCTCACCTCCTCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 81} {0: 1, 1: 0, 2: 2, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!