ID: 1006790375_1006790381

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1006790375 1006790381
Species Human (GRCh38) Human (GRCh38)
Location 6:36697501-36697523 6:36697519-36697541
Sequence CCCATCAACCTGCTGCTGTCTGG TCTGGGATAAGGCATTGCCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!