ID: 1006791443_1006791449

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1006791443 1006791449
Species Human (GRCh38) Human (GRCh38)
Location 6:36703850-36703872 6:36703885-36703907
Sequence CCTGTGTAACCACCCTCCAGGTC AGATTCTGCGTGCGGTGAATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 50, 4: 350} {0: 1, 1: 0, 2: 0, 3: 1, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!