ID: 1006801839_1006801844

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1006801839 1006801844
Species Human (GRCh38) Human (GRCh38)
Location 6:36764799-36764821 6:36764824-36764846
Sequence CCTGGCTCTCTGCAAACAGCTCC TGATGAGCCGAGGGCTGTACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 508} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!