ID: 1006807209_1006807224

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1006807209 1006807224
Species Human (GRCh38) Human (GRCh38)
Location 6:36796451-36796473 6:36796492-36796514
Sequence CCTCCCTCATAGGGCATCTCCAT GCCACGGGTGGGGGTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!