ID: 1006811112_1006811117

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1006811112 1006811117
Species Human (GRCh38) Human (GRCh38)
Location 6:36821219-36821241 6:36821237-36821259
Sequence CCTGGAGGCGGGGGCGGGCCGTG CCGTGTGACTGGAGTGGAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 52, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!